circad | circRNAs associated with diseases

hsa_circ_0000567
Gene	SETD3	Organism	Human
Genome Locus	chr14:99924615-99932150:-	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	29333615
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	102 paired CRC tissues and adjacent noncancerous tissues, 5 CRC cell lines, and a normal colorectal epithelial cell line
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGTTCGGTATCTTCAGTCCACAC Reverse TCTTACCCATTTTTCTGACTGGATG	Statistics	Fold Change : Downregulated pvalue : p<0.05
Citation
Wang, J, Li, X, Lu, L, He, L, Hu, H, Xu, Z (2018). Circular RNA hsa_circ_0000567 can be used as a promising diagnostic biomarker for human colorectal cancer. J. Clin. Lab. Anal., 32, 5:e22379.